X:153760914:G/C
GRCh37/hg19 position X:153760914
GRCh38/hg38 position X:154532699
Alleles (ref/alt) G/C
dbSNP rsid -
Gene symbol

G6PD

Most severe consequence missense_variant
Flanking sequence GCTGCACGCGGATCACCAGCTCGTTGCGCTT[G/C]CACTGCTGGTGGAAGATGTCGCCGGCCACAT
HGVS

NM_000402.4:c.1245C>G

NM_001042351.3:c.1155C>G

NM_001360016.2:c.1155C>G

More...

Gene annotations
Transcript Gene Exon number Consequence HGVS cDNA HGVS protein Location Protein location
NM_000402.4 G6PD 13 missense_variant c.1245C>G p.Cys415Trp Exon 10
NM_001042351.3 G6PD 13 missense_variant c.1155C>G p.Cys385Trp Exon 10
NM_001360016.2 G6PD 13 missense_variant c.1155C>G p.Cys385Trp Exon 10
Population frequency
Select populations: ALL LWK MKK YRI EUR FIN NFE CEU ASJ TSI EAS SAS CHB HAN CHD JPT AFR AMR ASW GIH MEX OTH
Database Population AC AN Hom Hemi AF
Functional predictions
Tool Score Prediction
SIFT 0.028 damaging
Polyphen2 HDIV 0.999 probably damaging
Polyphen2 HVAR 0.929 probably damaging
LRT 0.000000 deleterious
MutationTaster 1 disease_causing
MutationAssessor 2.07 medium
FATHMM -6.86 damaging
MetaSVM 1.0176 damaging
MetaLR 0.9861 damaging
PROVEAN -4.45 damaging
M-CAP 0.809382836095 damaging
CADD 4.680521 -
Conservation scores are retrieved from UCSC genome browser. The conservation levels are defined by simple cutoff values. If the conservation levels do not agree with each other, you can manually check whether this variant is conserved with UCSC genome browser.
Method Score Level
GERP++ 4.95 Conserved
phastCons46way primates 0.718 Conserved
phastCons46way placental 0.718 Conserved
phastCons100way vertebrates 1 Highly conserved
phyloP46way primates 0.597 Conserved
phyloP46way placental 2.457 Conserved
phyloP100way vertebrates 1.753 Not conserved
InterVar

InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.

Class: Likely pathogenic
Benign Pathogenic
Strong Supporting Supporting Moderate Strong Very Strong
Population data BA1
BS1
BS2
PM2 PS4
Computational and predictive data BP1
BP3
BP4
BP7
PP3 PM4
PM5
PS1 PVS1
Functional data BS3 PP2 PM1 PS3
Segregation data BS4 PP1 PP1 PP1
De novo data PM6 PS2
Allelic data BP2 PM3
Other database BP6 PP5
Other data BP5 PP4
Amino acid change

The physichemical property of amino acid change.

Trait Cys (C) Trp (W)
Amino acid name Cysteine Tryptophan
Side chain class sulfur-containing aromatic
Polarity nonpolar nonpolar
Charge (pH=7.4) neutrally charged neutrally charged
Hydropathy moderate hydrophobic
Molecular weight 121.154 204.228
gnomAD
The Genome Aggregation Database (gnomAD), is a coalition of investigators seeking to aggregate and harmonize exome and genome sequencing data from a variety of large-scale sequencing projects, and to make summary data available for the wider scientific community. In its first release, which contained exclusively exome data, it was known as the Exome Aggregation Consortium (ExAC).