| GRCh37/hg19 position | 12:103306579 |
| GRCh38/hg38 position | 12:102912801 |
| Alleles (ref/alt) | C/T |
| dbSNP rsid | rs118092776 |
| Gene symbol |
PAH |
| Most severe consequence | missense_variant |
| Flanking sequence | AAACATGATTGTAGCACTGACCTCAAATAAG[C/T]GCAATACTTTGGCCAATGCACCAACTTCTTC |
| HGVS |
NM_000277.3:c.158G>A NM_001354304.2:c.158G>A NP_000268.1:p.Arg53His |
| Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
| NM_000277.3 | PAH | 13 | missense_variant | c.158G>A | p.Arg53His | Exon 2 |
|
||||
| NM_001354304.2 | PAH | 14 | missense_variant | c.158G>A | p.Arg53His | Exon 3 |
|
| Database | Population | AC | AN | Hom | AF |
| 1000 genomes | ALL | 15 | 5008 | - | 0.00299521 |
| EUR | - | - | - | 0.002 | |
| EAS | - | - | - | 0.0119 | |
| SAS | - | - | - | 0.001 | |
| AFR | - | - | - | 0 | |
| AMR | - | - | - | 0 | |
| ExAC | ALL | 212 | 121382 | 1 | 0.001747 |
| FIN | 1 | 6610 | 0 | 0.000151 | |
| NFE | 45 | 66726 | 0 | 0.000674 | |
| EAS | 138 | 8648 | 1 | 0.015957 | |
| SAS | 22 | 16508 | 0 | 0.001333 | |
| AFR | 1 | 10404 | 0 | 0.000096 | |
| AMR | 4 | 11578 | 0 | 0.000345 | |
| OTH | 1 | 908 | 0 | 0.001101 | |
| gnomAD genomes | ALL | 34 | 30968 | 0 | 0.00109791 |
| FIN | 1 | 3492 | 0 | 0.000286369 | |
| NFE | 9 | 15006 | 0 | 0.00059976 | |
| ASJ | 0 | 302 | 0 | 0 | |
| EAS | 21 | 1620 | 0 | 0.012963 | |
| AFR | 2 | 8728 | 0 | 0.000229148 | |
| AMR | 0 | 838 | 0 | 0 | |
| OTH | 1 | 982 | 0 | 0.00101833 | |
| gnomAD exomes | ALL | 410 | 246138 | 3 | 0.00166573 |
| FIN | 2 | 22274 | 0 | 8.97908e-05 | |
| NFE | 77 | 111620 | 0 | 0.000689841 | |
| ASJ | 2 | 9848 | 0 | 0.000203087 | |
| EAS | 244 | 17248 | 3 | 0.0141466 | |
| SAS | 45 | 30780 | 0 | 0.00146199 | |
| AFR | 1 | 15304 | 0 | 6.53424e-05 | |
| AMR | 31 | 33580 | 0 | 0.000923169 | |
| OTH | 8 | 5484 | 0 | 0.00145879 | |
| CONVERGE | ALL | - | - | - | 0.017 |
| HRC | ALL | 46 | 64976 | - | 0.000707954 |
| Tool | Score | Prediction |
|---|---|---|
| SIFT | 0.053 | tolerated |
| Polyphen2 HDIV | 0.882 | possibly damaging |
| Polyphen2 HVAR | 0.305 | benign |
| LRT | 0.000008 | deleterious |
| MutationTaster | 0.999993 | disease_causing |
| MutationAssessor | 2.22 | medium |
| FATHMM | -5.54 | damaging |
| MetaSVM | 0.7392 | damaging |
| MetaLR | 0.9016 | damaging |
| PROVEAN | -2.76 | damaging |
| CADD | 2.933166 | - |
| REVEL | 0.789 | - |
| Method | Score | Level |
| GERP++ | 5.46 | Conserved |
| phastCons46way primates | 0.922 | Highly conserved |
| phastCons46way placental | 1.000 | Highly conserved |
| phastCons100way vertebrates | 1.000 | Highly conserved |
| phyloP46way primates | 0.655 | Conserved |
| phyloP46way placental | 2.549 | Conserved |
| phyloP100way vertebrates | 3.178 | Not conserved |
| Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
|---|---|---|---|---|---|---|---|---|
| RCV003398704 | Uncertain significance | 2023-03-03 | criteria provided, single submitter | clinical testing | PAH-related disorder | - | - | |
| RCV000490373 | Uncertain significance | 2018-08-10 | reviewed by expert panel | clinical testing | Phenylketonuria | PKU | Autosomal recessive inheritance | |
| RCV001175359 | Benign | 2022-02-24 | criteria provided, single submitter | clinical testing | not specified | - | - | |
| RCV000088842 | Uncertain significance | 2024-05-07 | criteria provided, single submitter | literature only | not provided | - | - | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
| Benign | Pathogenic | |||||
|---|---|---|---|---|---|---|
| Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
| Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
| Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
| Functional data | BS3 | PP2 | PM1 | PS3 | ||
| Segregation data | BS4 | PP1 | PP1 | PP1 | ||
| De novo data | PM6 | PS2 | ||||
| Allelic data | BP2 | PM3 | ||||
| Other database | BP6 | PP5 | ||||
| Other data | BP5 | PP4 | ||||
The physichemical property of amino acid change.
| Trait | Arg (R) | His (H) |
| Amino acid name | Arginine | Histidine |
| Side chain class | basic | basic aromatic |
| Polarity | basic polar | basic polar |
| Charge (pH=7.4) | positively charged | positively or neutrally charged |
| Hydropathy | hydrophilic | moderate |
| Molecular weight | 174.203 | 155.156 |