12:103306579:C/T
GRCh37/hg19 position 12:103306579
GRCh38/hg38 position 12:102912801
Alleles (ref/alt) C/T
dbSNP rsid rs118092776
Gene symbol

PAH

Most severe consequence missense_variant
Flanking sequence AAACATGATTGTAGCACTGACCTCAAATAAG[C/T]GCAATACTTTGGCCAATGCACCAACTTCTTC
HGVS

NM_000277.3:c.158G>A

NM_001354304.2:c.158G>A

NP_000268.1:p.Arg53His

More...

Gene annotations
Transcript Gene Exon number Consequence HGVS cDNA HGVS protein Location Protein location
NM_000277.3 PAH 13 missense_variant c.158G>A p.Arg53His Exon 2
NM_001354304.2 PAH 14 missense_variant c.158G>A p.Arg53His Exon 3
Population frequency
Select populations: ALL LWK MKK YRI EUR FIN NFE CEU ASJ TSI EAS SAS CHB HAN CHD JPT AFR AMR ASW GIH MEX OTH
Database Population AC AN Hom AF
1000 genomes ALL 15 5008 - 0.00299521
EUR - - - 0.002
EAS - - - 0.0119
SAS - - - 0.001
AFR - - - 0
AMR - - - 0
ExAC ALL 212 121382 1 0.001747
FIN 1 6610 0 0.000151
NFE 45 66726 0 0.000674
EAS 138 8648 1 0.015957
SAS 22 16508 0 0.001333
AFR 1 10404 0 0.000096
AMR 4 11578 0 0.000345
OTH 1 908 0 0.001101
gnomAD genomes ALL 34 30968 0 0.00109791
FIN 1 3492 0 0.000286369
NFE 9 15006 0 0.00059976
ASJ 0 302 0 0
EAS 21 1620 0 0.012963
AFR 2 8728 0 0.000229148
AMR 0 838 0 0
OTH 1 982 0 0.00101833
gnomAD exomes ALL 410 246138 3 0.00166573
FIN 2 22274 0 8.97908e-05
NFE 77 111620 0 0.000689841
ASJ 2 9848 0 0.000203087
EAS 244 17248 3 0.0141466
SAS 45 30780 0 0.00146199
AFR 1 15304 0 6.53424e-05
AMR 31 33580 0 0.000923169
OTH 8 5484 0 0.00145879
CONVERGE ALL - - - 0.017
HRC ALL 46 64976 - 0.000707954
Functional predictions
Tool Score Prediction
SIFT 0.005 damaging
Polyphen2 HDIV 0.987 probably damaging
Polyphen2 HVAR 0.612 possibly damaging
LRT 0.000008 deleterious
MutationTaster 0.999993 disease_causing
MutationAssessor 2.22 medium
FATHMM -5.54 damaging
MetaSVM 0.7392 damaging
MetaLR 0.9016 damaging
PROVEAN -2.8 damaging
CADD 5.665903 -
Conservation scores are retrieved from UCSC genome browser. The conservation levels are defined by simple cutoff values. If the conservation levels do not agree with each other, you can manually check whether this variant is conserved with UCSC genome browser.
Method Score Level
GERP++ 5.46 Conserved
phastCons46way primates 0.922 Highly conserved
phastCons46way placental 1.000 Highly conserved
phastCons100way vertebrates 1.000 Highly conserved
phyloP46way primates 0.655 Conserved
phyloP46way placental 2.549 Conserved
phyloP100way vertebrates 3.178 Not conserved
ClinVar
Accession Clinical significance Date last evaluated Review status Method Disease name Disease symbol Disease inheritance Pubmed
RCV000088842 Uncertain significance 2016-01-27 criteria provided, single submitter literature only not provided - -

9452061

24401910

26322415

RCV000490373 Conflicting interpretations of pathogenicity 2017-10-02 criteria provided, conflicting interpretations reference population Phenylketonuria PKU -

9452061

28492532

25741868

InterVar

InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.

Class: Uncertain significance
Benign Pathogenic
Strong Supporting Supporting Moderate Strong Very Strong
Population data BA1
BS1
BS2
PM2 PS4
Computational and predictive data BP1
BP3
BP4
BP7
PP3 PM4
PM5
PS1 PVS1
Functional data BS3 PP2 PM1 PS3
Segregation data BS4 PP1 PP1 PP1
De novo data PM6 PS2
Allelic data BP2 PM3
Other database BP6 PP5
Other data BP5 PP4
Amino acid change

The physichemical property of amino acid change.

Trait Arg (R) His (H)
Amino acid name Arginine Histidine
Side chain class basic basic aromatic
Polarity basic polar basic polar
Charge (pH=7.4) positively charged positively or neutrally charged
Hydropathy hydrophilic moderate
Molecular weight 174.203 155.156
gnomAD
The Genome Aggregation Database (gnomAD), is a coalition of investigators seeking to aggregate and harmonize exome and genome sequencing data from a variety of large-scale sequencing projects, and to make summary data available for the wider scientific community. In its first release, which contained exclusively exome data, it was known as the Exome Aggregation Consortium (ExAC).