| GRCh37/hg19 position | 12:103234244 |
| GRCh38/hg38 position | 12:102840466 |
| Alleles (ref/alt) | A/G |
| dbSNP rsid | rs62644471 |
| Gene symbol |
PAH |
| Most severe consequence | missense_variant |
| Flanking sequence | GTATTGTCCAAGACCTCAATCCTTTGGGTGT[A/G]TGGGTCGTAGCGAACTGAGAAGGGCCGAGGT |
| HGVS |
NM_000277.3:c.1249T>C NM_001354304.2:c.1249T>C NP_000268.1:p.Tyr417His |
| Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
| NM_000277.3 | PAH | 13 | missense_variant | c.1249T>C | p.Tyr417His | Exon 12 |
|
||||
| NM_001354304.2 | PAH | 14 | missense_variant | c.1249T>C | p.Tyr417His | Exon 13 |
|
| Database | Population | AC | AN | Hom | AF |
| Tool | Score | Prediction |
|---|---|---|
| SIFT | 0.159 | tolerated |
| Polyphen2 HDIV | 1 | probably damaging |
| Polyphen2 HVAR | 0.998 | probably damaging |
| LRT | 0.000000 | deleterious |
| MutationTaster | 1 | disease_causing |
| MutationAssessor | 2.62 | medium |
| FATHMM | -6.43 | damaging |
| MetaSVM | 1.0439 | damaging |
| MetaLR | 0.988 | damaging |
| PROVEAN | -4.52 | damaging |
| M-CAP | 0.74858 | damaging |
| CADD | 4.457744 | - |
| REVEL | 0.936 | - |
| Method | Score | Level |
| GERP++ | 5.33 | Conserved |
| phastCons46way primates | 0.955 | Highly conserved |
| phastCons46way placental | 0.976 | Highly conserved |
| phastCons100way vertebrates | 1.000 | Highly conserved |
| phyloP46way primates | 0.459 | Not conserved |
| phyloP46way placental | 2.152 | Conserved |
| phyloP100way vertebrates | 8.420 | Conserved |
| Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
|---|---|---|---|---|---|---|---|---|
| RCV000088817 | Pathogenic | 2017-07-21 | criteria provided, single submitter | literature only | not provided | - | - | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
| Benign | Pathogenic | |||||
|---|---|---|---|---|---|---|
| Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
| Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
| Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
| Functional data | BS3 | PP2 | PM1 | PS3 | ||
| Segregation data | BS4 | PP1 | PP1 | PP1 | ||
| De novo data | PM6 | PS2 | ||||
| Allelic data | BP2 | PM3 | ||||
| Other database | BP6 | PP5 | ||||
| Other data | BP5 | PP4 | ||||
The physichemical property of amino acid change.
| Trait | Tyr (Y) | His (H) |
| Amino acid name | Tyrosine | Histidine |
| Side chain class | aromatic | basic aromatic |
| Polarity | polar | basic polar |
| Charge (pH=7.4) | neutrally charged | positively or neutrally charged |
| Hydropathy | hydrophobic | moderate |
| Molecular weight | 181.191 | 155.156 |