GRCh37/hg19 position | 12:103234243 |
GRCh38/hg38 position | 12:102840465 |
Alleles (ref/alt) | T/C |
dbSNP rsid | - |
Gene symbol |
PAH |
Most severe consequence | missense_variant |
Flanking sequence | GGTATTGTCCAAGACCTCAATCCTTTGGGTG[T/C]ATGGGTCGTAGCGAACTGAGAAGGGCCGAGG |
HGVS |
NM_000277.3:c.1250A>G NM_001354304.2:c.1250A>G NP_000268.1:p.Tyr417Cys |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
NM_000277.3 | PAH | 13 | missense_variant | c.1250A>G | p.Tyr417Cys | Exon 12 |
|
||||
NM_001354304.2 | PAH | 14 | missense_variant | c.1250A>G | p.Tyr417Cys | Exon 13 |
|
Database | Population | AC | AN | Hom | AF |
gnomAD exomes | ALL | 1 | 246230 | 0 | 4.06124e-06 |
FIN | 0 | 22300 | 0 | 0 | |
NFE | 1 | 111702 | 0 | 8.95239e-06 | |
ASJ | 0 | 9850 | 0 | 0 | |
EAS | 0 | 17248 | 0 | 0 | |
SAS | 0 | 30782 | 0 | 0 | |
AFR | 0 | 15302 | 0 | 0 | |
AMR | 0 | 33564 | 0 | 0 | |
OTH | 0 | 5482 | 0 | 0 |
Tool | Score | Prediction |
---|---|---|
SIFT | 0 | damaging |
Polyphen2 HDIV | 0.975 | probably damaging |
Polyphen2 HVAR | 0.866 | possibly damaging |
LRT | 0.000000 | deleterious |
MutationTaster | 1 | disease_causing |
MutationAssessor | 3.77 | high |
FATHMM | -6.53 | damaging |
MetaSVM | 1.0041 | damaging |
MetaLR | 0.9876 | damaging |
PROVEAN | -8.08 | damaging |
M-CAP | 0.750798 | damaging |
CADD | 4.464548 | - |
REVEL | 0.95 | - |
Method | Score | Level |
GERP++ | 5.33 | Conserved |
phastCons46way primates | 0.967 | Highly conserved |
phastCons46way placental | 0.967 | Highly conserved |
phastCons100way vertebrates | 1 | Highly conserved |
phyloP46way primates | 0.459 | Not conserved |
phyloP46way placental | 2.152 | Conserved |
phyloP100way vertebrates | 7.248 | Conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV001789813 | Likely pathogenic | 2020-08-13 | reviewed by expert panel | curation | Phenylketonuria | PKU | Autosomal recessive inheritance | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |
The physichemical property of amino acid change.
Trait | Tyr (Y) | Cys (C) |
Amino acid name | Tyrosine | Cysteine |
Side chain class | aromatic | sulfur-containing |
Polarity | polar | nonpolar |
Charge (pH=7.4) | neutrally charged | neutrally charged |
Hydropathy | hydrophobic | moderate |
Molecular weight | 181.191 | 121.154 |