| GRCh37/hg19 position | 12:103234237 |
| GRCh38/hg38 position | 12:102840459 |
| Alleles (ref/alt) | T/C |
| dbSNP rsid | rs752255985 |
| Gene symbol |
PAH |
| Most severe consequence | missense_variant |
| Flanking sequence | CTGCTGGGTATTGTCCAAGACCTCAATCCTT[T/C]GGGTGTATGGGTCGTAGCGAACTGAGAAGGG |
| HGVS |
NM_000277.3:c.1256A>G NM_001354304.2:c.1256A>G NP_000268.1:p.Gln419Arg |
| Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
| NM_000277.3 | PAH | 13 | missense_variant | c.1256A>G | p.Gln419Arg | Exon 12 |
|
||||
| NM_001354304.2 | PAH | 14 | missense_variant | c.1256A>G | p.Gln419Arg | Exon 13 |
|
| Database | Population | AC | AN | Hom | AF |
| ExAC | ALL | 2 | 121346 | 0 | 0.000016 |
| FIN | 1 | 6614 | 0 | 0.000151 | |
| NFE | 1 | 66724 | 0 | 0.000015 | |
| EAS | 0 | 8654 | 0 | 0 | |
| SAS | 0 | 16510 | 0 | 0 | |
| AFR | 0 | 10406 | 0 | 0 | |
| AMR | 0 | 11530 | 0 | 0 | |
| OTH | 0 | 908 | 0 | 0 | |
| gnomAD exomes | ALL | 2 | 246226 | 0 | 8.12262e-06 |
| FIN | 1 | 22300 | 0 | 4.4843e-05 | |
| NFE | 0 | 111702 | 0 | 0 | |
| ASJ | 0 | 9850 | 0 | 0 | |
| EAS | 0 | 17248 | 0 | 0 | |
| SAS | 0 | 30782 | 0 | 0 | |
| AFR | 0 | 15302 | 0 | 0 | |
| AMR | 0 | 33560 | 0 | 0 | |
| OTH | 1 | 5482 | 0 | 0.000182415 |
| Tool | Score | Prediction |
|---|---|---|
| SIFT | 0.089 | tolerated |
| Polyphen2 HDIV | 0.49 | possibly damaging |
| Polyphen2 HVAR | 0.6 | possibly damaging |
| LRT | 0.000000 | deleterious |
| MutationTaster | 1 | disease_causing |
| MutationAssessor | 2.935 | medium |
| FATHMM | -6.06 | damaging |
| MetaSVM | 1.1104 | damaging |
| MetaLR | 0.9708 | damaging |
| PROVEAN | -3.02 | damaging |
| M-CAP | 0.481193 | damaging |
| CADD | 4.067199 | - |
| REVEL | 0.847 | - |
| Method | Score | Level |
| GERP++ | 5.33 | Conserved |
| phastCons46way primates | 0.994 | Highly conserved |
| phastCons46way placental | 1.000 | Highly conserved |
| phastCons100way vertebrates | 1.000 | Highly conserved |
| phyloP46way primates | 0.459 | Not conserved |
| phyloP46way placental | 2.152 | Conserved |
| phyloP100way vertebrates | 7.248 | Conserved |
| Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
|---|---|---|---|---|---|---|---|---|
| RCV000667759 | Pathogenic | 2020-06-22 | reviewed by expert panel | curation | Phenylketonuria | PKU | Autosomal recessive inheritance |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
| Benign | Pathogenic | |||||
|---|---|---|---|---|---|---|
| Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
| Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
| Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
| Functional data | BS3 | PP2 | PM1 | PS3 | ||
| Segregation data | BS4 | PP1 | PP1 | PP1 | ||
| De novo data | PM6 | PS2 | ||||
| Allelic data | BP2 | PM3 | ||||
| Other database | BP6 | PP5 | ||||
| Other data | BP5 | PP4 | ||||
The physichemical property of amino acid change.
| Trait | Gln (Q) | Arg (R) |
| Amino acid name | Glutamine | Arginine |
| Side chain class | amide | basic |
| Polarity | polar | basic polar |
| Charge (pH=7.4) | neutrally charged | positively charged |
| Hydropathy | hydrophilic | hydrophilic |
| Molecular weight | 146.146 | 174.203 |