GRCh37/hg19 position | 12:103234234 |
GRCh38/hg38 position | 12:102840456 |
Alleles (ref/alt) | C/A |
dbSNP rsid | rs767075719 |
Gene symbol |
PAH |
Most severe consequence | missense_variant |
Flanking sequence | AAGCTGCTGGGTATTGTCCAAGACCTCAATC[C/A]TTTGGGTGTATGGGTCGTAGCGAACTGAGAA |
HGVS |
NM_000277.3:c.1259G>T NM_001354304.2:c.1259G>T NP_000268.1:p.Arg420Met |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
NM_000277.3 | PAH | 13 | missense_variant | c.1259G>T | p.Arg420Met | Exon 12 |
|
||||
NM_001354304.2 | PAH | 14 | missense_variant | c.1259G>T | p.Arg420Met | Exon 13 |
|
Database | Population | AC | AN | Hom | AF |
ExAC | ALL | 1 | 121344 | 0 | 0.000008 |
FIN | 0 | 6614 | 0 | 0 | |
NFE | 1 | 66722 | 0 | 0.000015 | |
EAS | 0 | 8654 | 0 | 0 | |
SAS | 0 | 16510 | 0 | 0 | |
AFR | 0 | 10406 | 0 | 0 | |
AMR | 0 | 11530 | 0 | 0 | |
OTH | 0 | 908 | 0 | 0 | |
gnomAD exomes | ALL | 2 | 246220 | 0 | 8.12282e-06 |
FIN | 0 | 22300 | 0 | 0 | |
NFE | 2 | 111696 | 0 | 1.79057e-05 | |
ASJ | 0 | 9850 | 0 | 0 | |
EAS | 0 | 17248 | 0 | 0 | |
SAS | 0 | 30782 | 0 | 0 | |
AFR | 0 | 15302 | 0 | 0 | |
AMR | 0 | 33560 | 0 | 0 | |
OTH | 0 | 5482 | 0 | 0 |
Tool | Score | Prediction |
---|---|---|
SIFT | 0.013 | damaging |
Polyphen2 HDIV | 0.997 | probably damaging |
Polyphen2 HVAR | 0.87 | possibly damaging |
LRT | 0.000000 | deleterious |
MutationTaster | 1 | disease_causing |
MutationAssessor | 2.14 | medium |
FATHMM | -6.19 | damaging |
MetaSVM | 1.0838 | damaging |
MetaLR | 0.978 | damaging |
PROVEAN | -1.02 | neutral |
M-CAP | 0.792995 | damaging |
CADD | 4.310764 | - |
REVEL | 0.835 | - |
Method | Score | Level |
GERP++ | 5.33 | Conserved |
phastCons46way primates | 0.997 | Highly conserved |
phastCons46way placental | 0.997 | Highly conserved |
phastCons100way vertebrates | 1 | Highly conserved |
phyloP46way primates | 0.561 | Conserved |
phyloP46way placental | 2.664 | Conserved |
phyloP100way vertebrates | 5.363 | Conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV001200002 | Likely pathogenic | 2020-05-21 | reviewed by expert panel | clinical testing | Phenylketonuria | PKU | Autosomal recessive inheritance |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |
The physichemical property of amino acid change.
Trait | Arg (R) | Met (M) |
Amino acid name | Arginine | Methionine |
Side chain class | basic | sulfur-containing |
Polarity | basic polar | nonpolar |
Charge (pH=7.4) | positively charged | neutrally charged |
Hydropathy | hydrophilic | moderate |
Molecular weight | 174.203 | 149.208 |