GRCh37/hg19 position | 12:103234215 |
GRCh38/hg38 position | 12:102840437 |
Alleles (ref/alt) | A/G |
dbSNP rsid | rs59326968 |
Gene symbol |
PAH |
Most severe consequence | synonymous_variant |
Flanking sequence | TGGAATCAGCCAAAATCTTAAGCTGCTGGGT[A/G]TTGTCCAAGACCTCAATCCTTTGGGTGTATG |
HGVS |
NM_000277.3:c.1278T>C NM_001354304.2:c.1278T>C NP_000268.1:p.Asn426= |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
NM_000277.3 | PAH | 13 | synonymous_variant | c.1278T>C | p.Asn426= | Exon 12 |
|
||||
NM_001354304.2 | PAH | 14 | synonymous_variant | c.1278T>C | p.Asn426= | Exon 13 |
|
Database | Population | AC | AN | Hom | AF |
1000 genomes | ALL | 233 | 5008 | - | 0.0465256 |
EUR | - | - | - | 0.001 | |
EAS | - | - | - | 0 | |
SAS | - | - | - | 0 | |
AFR | - | - | - | 0.1664 | |
AMR | - | - | - | 0.0173 | |
ExAC | ALL | 1653 | 121330 | 104 | 0.013624 |
FIN | 1 | 6612 | 0 | 0.000151 | |
NFE | 33 | 66714 | 0 | 0.000495 | |
EAS | 0 | 8654 | 0 | 0 | |
SAS | 6 | 16510 | 0 | 0.000363 | |
AFR | 1525 | 10406 | 104 | 0.146550 | |
AMR | 82 | 11526 | 0 | 0.007114 | |
OTH | 6 | 908 | 0 | 0.006608 | |
gnomAD genomes | ALL | 1258 | 30958 | 88 | 0.0406357 |
FIN | 0 | 3492 | 0 | 0 | |
NFE | 9 | 15008 | 0 | 0.00059968 | |
ASJ | 0 | 302 | 0 | 0 | |
EAS | 0 | 1618 | 0 | 0 | |
AFR | 1238 | 8718 | 88 | 0.142005 | |
AMR | 4 | 838 | 0 | 0.00477327 | |
OTH | 7 | 982 | 0 | 0.00712831 | |
gnomAD exomes | ALL | 2611 | 246218 | 181 | 0.0106044 |
FIN | 1 | 22300 | 0 | 4.4843e-05 | |
NFE | 57 | 111688 | 0 | 0.00051035 | |
ASJ | 4 | 9850 | 0 | 0.000406091 | |
EAS | 1 | 17248 | 0 | 5.79777e-05 | |
SAS | 10 | 30782 | 1 | 0.000324865 | |
AFR | 2246 | 15302 | 178 | 0.146778 | |
AMR | 255 | 33564 | 2 | 0.00759743 | |
OTH | 37 | 5484 | 0 | 0.0067469 | |
HRC | ALL | 300 | 64976 | - | 0.00461709 |
Method | Score | Level |
GERP++ | -3.99 | Not conserved |
phastCons46way primates | 0.981 | Highly conserved |
phastCons46way placental | 0.872 | Conserved |
phastCons100way vertebrates | 0.914 | Highly conserved |
phyloP46way primates | 0.459 | Not conserved |
phyloP46way placental | -0.666 | Not conserved |
phyloP100way vertebrates | 0.063 | Not conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000088823 | Benign | 2021-01-13 | criteria provided, multiple submitters, no conflicts | clinical testing | not provided | - | - | |
RCV000400696 | Benign | 2018-08-10 | reviewed by expert panel | curation | Phenylketonuria | PKU | Autosomal recessive inheritance | |
RCV000078509 | Benign/Likely benign | 2012-10-18 | criteria provided, multiple submitters, no conflicts | clinical testing | not specified | - | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |