GRCh37/hg19 position | 12:103234211 |
GRCh38/hg38 position | 12:102840433 |
Alleles (ref/alt) | G/A |
dbSNP rsid | rs567261857 |
Gene symbol |
PAH |
Most severe consequence | stop_gained |
Flanking sequence | TTAATGGAATCAGCCAAAATCTTAAGCTGCT[G/A]GGTATTGTCCAAGACCTCAATCCTTTGGGTG |
HGVS |
NM_000277.3:c.1282C>T NM_001354304.2:c.1282C>T NP_000268.1:p.Gln428Ter |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
NM_000277.3 | PAH | 13 | stop_gained | c.1282C>T | p.Gln428Ter | Exon 12 |
|
||||
NM_001354304.2 | PAH | 14 | stop_gained | c.1282C>T | p.Gln428Ter | Exon 13 |
|
Database | Population | AC | AN | Hom | AF |
Tool | Score | Prediction |
---|---|---|
LRT | 0.004671 | neutral |
MutationTaster | 1 | disease_causing |
CADD | 7.771027 | - |
Method | Score | Level |
GERP++ | 2.28 | Conserved |
phastCons46way primates | 0.986 | Highly conserved |
phastCons46way placental | 0.995 | Highly conserved |
phastCons100way vertebrates | 0.999 | Highly conserved |
phyloP46way primates | 0.561 | Conserved |
phyloP46way placental | 1.323 | Not conserved |
phyloP100way vertebrates | 2.300 | Not conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000759177 | Likely pathogenic | 2018-04-26 | criteria provided, single submitter | clinical testing | not provided | - | - | |
RCV000410471 | Likely pathogenic | 2022-09-09 | criteria provided, multiple submitters, no conflicts | clinical testing | Phenylketonuria | PKU | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |
The physichemical property of amino acid change.
Trait | Gln (Q) | Ter |
Amino acid name | Glutamine | - |
Side chain class | amide | - |
Polarity | polar | - |
Charge (pH=7.4) | neutrally charged | - |
Hydropathy | hydrophilic | - |
Molecular weight | 146.146 | - |