GRCh37/hg19 position | 12:103234177 |
GRCh38/hg38 position | 12:102840399 |
Alleles (ref/alt) | C/A |
dbSNP rsid | rs5030861 |
Gene symbol |
PAH |
Most severe consequence | splice_donor_variant |
Flanking sequence | CCGAGTGGCCTCGTAAGGTGTAAATTACTTA[C/A]TGTTAATGGAATCAGCCAAAATCTTAAGCTG |
HGVS |
NM_000277.3:c.1315+1G>T NM_001354304.2:c.1315+1G>T |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
NM_000277.3 | PAH | - | splice_donor_variant | c.1315+1G>T | - | Intron 12 | ||
NM_001354304.2 | PAH | - | splice_donor_variant | c.1315+1G>T | - | Intron 13 |
Database | Population | AC | AN | Hom | AF |
Tool | Score | Prediction |
---|---|---|
MutationTaster | 1 | disease_causing |
CADD | 3.689522 | - |
Method | Score | Level |
GERP++ | 5.33 | Conserved |
phastCons46way primates | 0.591 | Conserved |
phastCons46way placental | 0.996 | Highly conserved |
phastCons100way vertebrates | 1.000 | Highly conserved |
phyloP46way primates | 0.561 | Conserved |
phyloP46way placental | 2.664 | Conserved |
phyloP100way vertebrates | 7.049 | Conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000410802 | Likely pathogenic | 2020-05-18 | reviewed by expert panel | clinical testing | Phenylketonuria | PKU | Autosomal recessive inheritance |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |