12:103234172:A/T
GRCh37/hg19 position 12:103234172
GRCh38/hg38 position 12:102840394
Alleles (ref/alt) A/T
dbSNP rsid rs62508650
Gene symbol

PAH

Most severe consequence intron_variant
Flanking sequence AGAAACCGAGTGGCCTCGTAAGGTGTAAATT[A/T]CTTACTGTTAATGGAATCAGCCAAAATCTTA
HGVS

NM_000277.1:c.1315+6T>A

Gene annotations
Transcript Gene Exon number Consequence HGVS cDNA HGVS protein Location Protein location
NM_000277.1 PAH - intron_variant c.1315+6T>A - Intron 12
Population frequency
Select populations: ALL LWK MKK YRI EUR FIN NFE CEU ASJ TSI EAS SAS CHB HAN CHD JPT AFR AMR ASW GIH MEX OTH
Database Population AC AN Hom AF
Conservation scores are retrieved from UCSC genome browser. The conservation levels are defined by simple cutoff values. If the conservation levels do not agree with each other, you can manually check whether this variant is conserved with UCSC genome browser.
Method Score Level
GERP++ 5.33 Conserved
phastCons46way primates 0.505 Conserved
phastCons46way placental 0.925 Highly conserved
phastCons100way vertebrates 0.155 Not conserved
phyloP46way primates 0.459 Not conserved
phyloP46way placental 2.152 Conserved
phyloP100way vertebrates 0.706 Not conserved
ClinVar
Accession Clinical significance Date last evaluated Review status Method Disease name Disease symbol Disease inheritance Pubmed
RCV000088829 not provided . no assertion provided literature only not provided - - -
RCV000668481 Likely pathogenic 2017-08-02 criteria provided, single submitter clinical testing Phenylketonuria PKU -

26503515

16256386

23932990

InterVar

InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.

Class: Uncertain significance
Benign Pathogenic
Strong Supporting Supporting Moderate Strong Very Strong
Population data BA1
BS1
BS2
PM2 PS4
Computational and predictive data BP1
BP3
BP4
BP7
PP3 PM4
PM5
PS1 PVS1
Functional data BS3 PP2 PM1 PS3
Segregation data BS4 PP1 PP1 PP1
De novo data PM6 PS2
Allelic data BP2 PM3
Other database BP6 PP5
Other data BP5 PP4
gnomAD
The Genome Aggregation Database (gnomAD), is a coalition of investigators seeking to aggregate and harmonize exome and genome sequencing data from a variety of large-scale sequencing projects, and to make summary data available for the wider scientific community. In its first release, which contained exclusively exome data, it was known as the Exome Aggregation Consortium (ExAC).