12:103232981:A/G
GRCh37/hg19 position 12:103232981
GRCh38/hg38 position 12:102839203
Alleles (ref/alt) A/G
dbSNP rsid -
Gene symbol

PAH

Most severe consequence missense_variant
Flanking sequence GCTTTACTTTATTTTCTGGAGGGCACTGCAA[A/G]GGATTCCAATTTCACCTACAAAGAAAAACAC
HGVS

NM_000277.1:c.1331T>C

NP_000268.1:p.Leu444Pro

Gene annotations
Transcript Gene Exon number Consequence HGVS cDNA HGVS protein Location Protein location
NM_000277.1 PAH 13 missense_variant c.1331T>C p.Leu444Pro Exon 13
Population frequency
Select populations: ALL LWK MKK YRI EUR FIN NFE CEU ASJ TSI EAS SAS CHB HAN CHD JPT AFR AMR ASW GIH MEX OTH
Database Population AC AN Hom AF
Functional predictions
Tool Score Prediction
SIFT 0 damaging
Polyphen2 HDIV 1.0 probably damaging
Polyphen2 HVAR 0.998 probably damaging
LRT 0.000000 deleterious
MutationTaster 1 disease_causing
MutationAssessor 4.02 high
FATHMM -6.62 damaging
MetaSVM 0.9731 damaging
MetaLR 0.9910 damaging
PROVEAN -5.73 damaging
M-CAP 0.769890041735 damaging
CADD 6.669162 -
Conservation scores are retrieved from UCSC genome browser. The conservation levels are defined by simple cutoff values. If the conservation levels do not agree with each other, you can manually check whether this variant is conserved with UCSC genome browser.
Method Score Level
GERP++ 5.31 Conserved
phastCons46way primates 0.969 Highly conserved
phastCons46way placental 0.969 Highly conserved
phastCons100way vertebrates 1 Highly conserved
phyloP46way primates 0.477 Not conserved
phyloP46way placental 2.136 Conserved
phyloP100way vertebrates 6.523 Conserved
InterVar

InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.

Class: Uncertain significance
Benign Pathogenic
Strong Supporting Supporting Moderate Strong Very Strong
Population data BA1
BS1
BS2
PM2 PS4
Computational and predictive data BP1
BP3
BP4
BP7
PP3 PM4
PM5
PS1 PVS1
Functional data BS3 PP2 PM1 PS3
Segregation data BS4 PP1 PP1 PP1
De novo data PM6 PS2
Allelic data BP2 PM3
Other database BP6 PP5
Other data BP5 PP4
Amino acid change

The physichemical property of amino acid change.

Trait Leu (L) Pro (P)
Amino acid name Leucine Proline
Side chain class aliphatic cyclic
Polarity nonpolar nonpolar
Charge (pH=7.4) neutrally charged neutrally charged
Hydropathy hydrophobic hydrophobic
Molecular weight 131.175 115.132
gnomAD
The Genome Aggregation Database (gnomAD), is a coalition of investigators seeking to aggregate and harmonize exome and genome sequencing data from a variety of large-scale sequencing projects, and to make summary data available for the wider scientific community. In its first release, which contained exclusively exome data, it was known as the Exome Aggregation Consortium (ExAC).