GRCh37/hg19 position | 12:103232973 |
GRCh38/hg38 position | 12:102839195 |
Alleles (ref/alt) | C/G |
dbSNP rsid | - |
Gene symbol |
PAH |
Most severe consequence | missense_variant |
Flanking sequence | TGTCCATGGCTTTACTTTATTTTCTGGAGGG[C/G]ACTGCAAAGGATTCCAATTTCACCTACAAAG |
HGVS |
NM_000277.3:c.1339G>C NM_001354304.2:c.1339G>C NP_000268.1:p.Ala447Pro |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
NM_000277.3 | PAH | 13 | missense_variant | c.1339G>C | p.Ala447Pro | Exon 13 |
|
||||
NM_001354304.2 | PAH | 14 | missense_variant | c.1339G>C | p.Ala447Pro | Exon 14 |
|
Database | Population | AC | AN | Hom | AF |
Tool | Score | Prediction |
---|---|---|
SIFT | 0.001 | damaging |
Polyphen2 HDIV | 0.999 | probably damaging |
Polyphen2 HVAR | 0.982 | probably damaging |
LRT | 0.000000 | deleterious |
MutationTaster | 1 | disease_causing |
MutationAssessor | 4.075 | high |
FATHMM | -6.71 | damaging |
MetaSVM | 0.9573 | damaging |
MetaLR | 0.9932 | damaging |
PROVEAN | -3.87 | damaging |
M-CAP | 0.705344 | damaging |
CADD | 4.243311 | - |
REVEL | 0.959 | - |
Method | Score | Level |
GERP++ | 5.31 | Conserved |
phastCons46way primates | 0.98 | Highly conserved |
phastCons46way placental | 0.98 | Highly conserved |
phastCons100way vertebrates | 1 | Highly conserved |
phyloP46way primates | 0.585 | Conserved |
phyloP46way placental | 2.645 | Conserved |
phyloP100way vertebrates | 5.491 | Conserved |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |
The physichemical property of amino acid change.
Trait | Ala (A) | Pro (P) |
Amino acid name | Alanine | Proline |
Side chain class | aliphatic | cyclic |
Polarity | nonpolar | nonpolar |
Charge (pH=7.4) | neutrally charged | neutrally charged |
Hydropathy | hydrophobic | hydrophobic |
Molecular weight | 89.094 | 115.132 |