GRCh37/hg19 position | 12:103232972 |
GRCh38/hg38 position | 12:102839194 |
Alleles (ref/alt) | G/T |
dbSNP rsid | rs76542238 |
Gene symbol |
PAH |
Most severe consequence | missense_variant |
Flanking sequence | CTGTCCATGGCTTTACTTTATTTTCTGGAGG[G/T]CACTGCAAAGGATTCCAATTTCACCTACAAA |
HGVS |
NM_000277.3:c.1340C>A NM_001354304.2:c.1340C>A NP_000268.1:p.Ala447Asp |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
NM_000277.3 | PAH | 13 | missense_variant | c.1340C>A | p.Ala447Asp | Exon 13 |
|
||||
NM_001354304.2 | PAH | 14 | missense_variant | c.1340C>A | p.Ala447Asp | Exon 14 |
|
Database | Population | AC | AN | Hom | AF |
ExAC | ALL | 1 | 120896 | 0 | 0.000008 |
FIN | 0 | 6600 | 0 | 0 | |
NFE | 1 | 66508 | 0 | 0.000015 | |
EAS | 0 | 8616 | 0 | 0 | |
SAS | 0 | 16474 | 0 | 0 | |
AFR | 0 | 10326 | 0 | 0 | |
AMR | 0 | 11464 | 0 | 0 | |
OTH | 0 | 908 | 0 | 0 | |
gnomAD genomes | ALL | 1 | 30966 | 0 | 3.22935e-05 |
FIN | 0 | 3490 | 0 | 0 | |
NFE | 1 | 15010 | 0 | 6.66223e-05 | |
ASJ | 0 | 302 | 0 | 0 | |
EAS | 0 | 1614 | 0 | 0 | |
AFR | 0 | 8730 | 0 | 0 | |
AMR | 0 | 838 | 0 | 0 | |
OTH | 0 | 982 | 0 | 0 | |
gnomAD exomes | ALL | 2 | 245904 | 0 | 8.13326e-06 |
FIN | 0 | 22262 | 0 | 0 | |
NFE | 2 | 111490 | 0 | 1.79388e-05 | |
ASJ | 0 | 9848 | 0 | 0 | |
EAS | 0 | 17244 | 0 | 0 | |
SAS | 0 | 30774 | 0 | 0 | |
AFR | 0 | 15282 | 0 | 0 | |
AMR | 0 | 33530 | 0 | 0 | |
OTH | 0 | 5474 | 0 | 0 |
Tool | Score | Prediction |
---|---|---|
SIFT | 0 | damaging |
Polyphen2 HDIV | 0.998 | probably damaging |
Polyphen2 HVAR | 0.976 | probably damaging |
LRT | 0.000000 | deleterious |
MutationTaster | 1 | disease_causing |
MutationAssessor | 4.075 | high |
FATHMM | -6.7 | damaging |
MetaSVM | 0.9573 | damaging |
MetaLR | 0.9932 | damaging |
PROVEAN | -4.6 | damaging |
M-CAP | 0.749822 | damaging |
CADD | 4.308411 | - |
REVEL | 0.963 | - |
Method | Score | Level |
GERP++ | 5.31 | Conserved |
phastCons46way primates | 0.981 | Highly conserved |
phastCons46way placental | 0.995 | Highly conserved |
phastCons100way vertebrates | 1.000 | Highly conserved |
phyloP46way primates | 0.585 | Conserved |
phyloP46way placental | 2.645 | Conserved |
phyloP100way vertebrates | 6.878 | Conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000632880 | Pathogenic | 2022-09-12 | criteria provided, multiple submitters, no conflicts | clinical testing | Phenylketonuria | PKU | - | |
RCV000088834 | Pathogenic | 2022-07-21 | criteria provided, single submitter | literature only | not provided | - | - | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |
The physichemical property of amino acid change.
Trait | Ala (A) | Asp (D) |
Amino acid name | Alanine | Aspartic acid |
Side chain class | aliphatic | acid |
Polarity | nonpolar | acidic polar |
Charge (pH=7.4) | neutrally charged | negatively charged |
Hydropathy | hydrophobic | hydrophilic |
Molecular weight | 89.094 | 133.104 |