GRCh37/hg19 position | 12:103232951 |
GRCh38/hg38 position | 12:102839173 |
Alleles (ref/alt) | CTTTA/- |
dbSNP rsid | rs794727086 |
Gene symbol |
PAH |
Most severe consequence | stop_lost |
Flanking sequence | TCACAGCTGACAGACCACATTCTGTCCATGG[CTTTA/-]CTTTATTTTCTGGAGGGCACTGCAAAGGATT |
HGVS |
NM_000277.3:c.1357_*2del NM_001354304.2:c.1357_*2del |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
NM_000277.3 | PAH | 13 | stop_lost | c.1357_*2del | - | Exon 13 |
|
||||
NM_001354304.2 | PAH | 14 | stop_lost | c.1357_*2del | - | Exon 14 |
|
Database | Population | AC | AN | Hom | AF |
Method | Score | Level |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000174462 | Pathogenic | 2015-02-02 | criteria provided, single submitter | clinical testing | Phenylketonuria | PKU | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |