GRCh37/hg19 position | 12:103232934 |
GRCh38/hg38 position | 12:102839156 |
Alleles (ref/alt) | C/A |
dbSNP rsid | rs372637021 |
Gene symbol |
PAH |
Most severe consequence | 3_prime_UTR_variant |
Flanking sequence | GATCTCCATCAACAGATTCACAGCTGACAGA[C/A]CACATTCTGTCCATGGCTTTACTTTATTTTC |
HGVS |
NM_000277.3:c.*19G>T NM_001354304.2:c.*19G>T |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
NM_000277.3 | PAH | 13 | 3_prime_UTR_variant | c.*19G>T | - | 3' UTR | ||
NM_001354304.2 | PAH | 14 | 3_prime_UTR_variant | c.*19G>T | - | 3' UTR |
Database | Population | AC | AN | Hom | AF |
1000 genomes | ALL | 13 | 5008 | - | 0.00259585 |
EUR | - | - | - | 0.002 | |
EAS | - | - | - | 0.001 | |
SAS | - | - | - | 0.0102 | |
AFR | - | - | - | 0 | |
AMR | - | - | - | 0 | |
ExAC | ALL | 261 | 120776 | 5 | 0.002161 |
FIN | 1 | 6600 | 0 | 0.000152 | |
NFE | 84 | 66444 | 1 | 0.001264 | |
EAS | 22 | 8606 | 0 | 0.002556 | |
SAS | 129 | 16472 | 3 | 0.007831 | |
AFR | 2 | 10310 | 0 | 0.000194 | |
AMR | 20 | 11438 | 1 | 0.001749 | |
OTH | 3 | 906 | 0 | 0.003311 | |
gnomAD genomes | ALL | 25 | 30978 | 0 | 0.000807024 |
FIN | 0 | 3494 | 0 | 0 | |
NFE | 16 | 15010 | 0 | 0.00106596 | |
ASJ | 0 | 302 | 0 | 0 | |
EAS | 3 | 1618 | 0 | 0.00185414 | |
AFR | 5 | 8734 | 0 | 0.000572475 | |
AMR | 1 | 838 | 0 | 0.00119332 | |
OTH | 0 | 982 | 0 | 0 | |
gnomAD exomes | ALL | 539 | 245694 | 8 | 0.00219379 |
FIN | 2 | 22252 | 0 | 8.98796e-05 | |
NFE | 159 | 111330 | 2 | 0.00142819 | |
ASJ | 9 | 9842 | 0 | 0.000914448 | |
EAS | 42 | 17240 | 0 | 0.00243619 | |
SAS | 250 | 30776 | 4 | 0.00812321 | |
AFR | 1 | 15282 | 0 | 6.54365e-05 | |
AMR | 62 | 33502 | 2 | 0.00185064 | |
OTH | 14 | 5470 | 0 | 0.00255941 | |
CONVERGE | ALL | - | - | - | 0.002 |
HRC | ALL | 82 | 64976 | - | 0.001262 |
Method | Score | Level |
GERP++ | -2.17 | Not conserved |
phastCons46way primates | 0.035 | Not conserved |
phastCons46way placental | 0.000 | Not conserved |
phastCons100way vertebrates | 0.000 | Not conserved |
phyloP46way primates | -0.490 | Not conserved |
phyloP46way placental | -0.406 | Not conserved |
phyloP100way vertebrates | -0.788 | Not conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000252084 | Likely benign | 2023-01-25 | criteria provided, multiple submitters, no conflicts | clinical testing | not specified | - | - | |
RCV000538868 | Uncertain significance | 2019-09-27 | reviewed by expert panel | clinical testing | Phenylketonuria | PKU | Autosomal recessive inheritance |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |