12:103232934:C/A
GRCh37/hg19 position 12:103232934
GRCh38/hg38 position 12:102839156
Alleles (ref/alt) C/A
dbSNP rsid rs372637021
Gene symbol

PAH

Most severe consequence 3_prime_UTR_variant
Flanking sequence GATCTCCATCAACAGATTCACAGCTGACAGA[C/A]CACATTCTGTCCATGGCTTTACTTTATTTTC
HGVS

NM_000277.1:c.*19G>T

Gene annotations
Transcript Gene Exon number Consequence HGVS cDNA HGVS protein Location Protein location
NM_000277.1 PAH 13 3_prime_UTR_variant c.*19G>T - 3' UTR
Population frequency
Select populations: ALL LWK MKK YRI EUR FIN NFE CEU ASJ TSI EAS SAS CHB HAN CHD JPT AFR AMR ASW GIH MEX OTH
Database Population AC AN Hom AF
1000 genomes ALL 13 5008 - 0.00259585
EUR - - - 0.002
EAS - - - 0.001
SAS - - - 0.0102
AFR - - - 0
AMR - - - 0
ExAC ALL 261 120776 5 0.002161
FIN 1 6600 0 0.000152
NFE 84 66444 1 0.001264
EAS 22 8606 0 0.002556
SAS 129 16472 3 0.007831
AFR 2 10310 0 0.000194
AMR 20 11438 1 0.001749
OTH 3 906 0 0.003311
gnomAD genomes ALL 25 30978 0 0.000807024
FIN 0 3494 0 0
NFE 16 15010 0 0.00106596
ASJ 0 302 0 0
EAS 3 1618 0 0.00185414
AFR 5 8734 0 0.000572475
AMR 1 838 0 0.00119332
OTH 0 982 0 0
gnomAD exomes ALL 539 245694 8 0.00219379
FIN 2 22252 0 8.98796e-05
NFE 159 111330 2 0.00142819
ASJ 9 9842 0 0.000914448
EAS 42 17240 0 0.00243619
SAS 250 30776 4 0.00812321
AFR 1 15282 0 6.54365e-05
AMR 62 33502 2 0.00185064
OTH 14 5470 0 0.00255941
CONVERGE ALL - - - 0.002
HRC ALL 82 64976 - 0.001262
Conservation scores are retrieved from UCSC genome browser. The conservation levels are defined by simple cutoff values. If the conservation levels do not agree with each other, you can manually check whether this variant is conserved with UCSC genome browser.
Method Score Level
GERP++ -2.17 Not conserved
phastCons46way primates 0.035 Not conserved
phastCons46way placental 0.000 Not conserved
phastCons100way vertebrates 0.000 Not conserved
phyloP46way primates -0.490 Not conserved
phyloP46way placental -0.406 Not conserved
phyloP100way vertebrates -0.788 Not conserved
ClinVar
Accession Clinical significance Date last evaluated Review status Method Disease name Disease symbol Disease inheritance Pubmed
RCV000252084 Likely benign 2017-08-17 criteria provided, multiple submitters, no conflicts clinical testing not specified - -

26210745

26467025

25741868

RCV000538868 Conflicting interpretations of pathogenicity 2017-04-27 criteria provided, conflicting interpretations clinical testing Phenylketonuria PKU -

12765842

28492532

InterVar

InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.

Class: Uncertain significance
Benign Pathogenic
Strong Supporting Supporting Moderate Strong Very Strong
Population data BA1
BS1
BS2
PM2 PS4
Computational and predictive data BP1
BP3
BP4
BP7
PP3 PM4
PM5
PS1 PVS1
Functional data BS3 PP2 PM1 PS3
Segregation data BS4 PP1 PP1 PP1
De novo data PM6 PS2
Allelic data BP2 PM3
Other database BP6 PP5
Other data BP5 PP4
gnomAD
The Genome Aggregation Database (gnomAD), is a coalition of investigators seeking to aggregate and harmonize exome and genome sequencing data from a variety of large-scale sequencing projects, and to make summary data available for the wider scientific community. In its first release, which contained exclusively exome data, it was known as the Exome Aggregation Consortium (ExAC).