GRCh37/hg19 position | 12:103232809 |
GRCh38/hg38 position | 12:102839031 |
Alleles (ref/alt) | T/C |
dbSNP rsid | rs375319584 |
Gene symbol |
PAH |
Most severe consequence | 3_prime_UTR_variant |
Flanking sequence | CTCATATCCTGTCATTTCAGATTATTTTGAC[T/C]TATTTGTTGTTTCTCCATCTTGTAAAGGATT |
HGVS |
NM_000277.3:c.*144A>G NM_001354304.2:c.*144A>G |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
NM_000277.3 | PAH | 13 | 3_prime_UTR_variant | c.*144A>G | - | 3' UTR | ||
NM_001354304.2 | PAH | 14 | 3_prime_UTR_variant | c.*144A>G | - | 3' UTR |
Database | Population | AC | AN | Hom | AF |
1000 genomes | ALL | 17 | 5008 | - | 0.00339457 |
EUR | - | - | - | 0 | |
EAS | - | - | - | 0.001 | |
SAS | - | - | - | 0.0164 | |
AFR | - | - | - | 0 | |
AMR | - | - | - | 0 | |
gnomAD genomes | ALL | 4 | 30972 | 0 | 0.000129149 |
FIN | 0 | 3494 | 0 | 0 | |
NFE | 0 | 15004 | 0 | 0 | |
ASJ | 0 | 302 | 0 | 0 | |
EAS | 2 | 1618 | 0 | 0.00123609 | |
AFR | 1 | 8734 | 0 | 0.000114495 | |
AMR | 0 | 838 | 0 | 0 | |
OTH | 1 | 982 | 0 | 0.00101833 | |
CONVERGE | ALL | - | - | - | 0.002 |
HRC | ALL | 17 | 64976 | - | 0.000261635 |
Method | Score | Level |
GERP++ | 2.3 | Conserved |
phastCons46way primates | 0.002 | Not conserved |
phastCons46way placental | 0.002 | Not conserved |
phastCons100way vertebrates | 0.643 | Conserved |
phyloP46way primates | -0.399 | Not conserved |
phyloP46way placental | 0.384 | Not conserved |
phyloP100way vertebrates | 0.279 | Not conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000814338 | Uncertain significance | 2020-12-23 | reviewed by expert panel | curation | Phenylketonuria | PKU | Autosomal recessive inheritance |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |