GRCh37/hg19 position | 12:103232766 |
GRCh38/hg38 position | 12:102838988 |
Alleles (ref/alt) | C/T |
dbSNP rsid | rs1801153 |
Gene symbol |
PAH |
Most severe consequence | 3_prime_UTR_variant |
Flanking sequence | AAGATGACCCCAAAAGATTTACCATTATGCT[C/T]TTGAGTATGTACTCATATCCTGTCATTTCAG |
HGVS |
NM_000277.3:c.*187G>A NM_001354304.2:c.*187G>A |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
NM_000277.3 | PAH | 13 | 3_prime_UTR_variant | c.*187G>A | - | 3' UTR | ||
NM_001354304.2 | PAH | 14 | 3_prime_UTR_variant | c.*187G>A | - | 3' UTR |
Database | Population | AC | AN | Hom | AF |
1000 genomes | ALL | 1465 | 5008 | - | 0.292532 |
EUR | - | - | - | 0.2078 | |
EAS | - | - | - | 0.006 | |
SAS | - | - | - | 0.1411 | |
AFR | - | - | - | 0.6415 | |
AMR | - | - | - | 0.3804 | |
gnomAD genomes | ALL | 9340 | 30892 | 1952 | 0.302344 |
FIN | 659 | 3490 | 59 | 0.188825 | |
NFE | 3030 | 14976 | 322 | 0.202324 | |
ASJ | 54 | 302 | 6 | 0.178808 | |
EAS | 10 | 1614 | 0 | 0.00619579 | |
AFR | 5048 | 8704 | 1475 | 0.579963 | |
AMR | 327 | 834 | 70 | 0.392086 | |
OTH | 212 | 972 | 20 | 0.218107 | |
CONVERGE | ALL | - | - | - | 0.007 |
HRC | ALL | 13338 | 64976 | - | 0.205276 |
Method | Score | Level |
GERP++ | 1.66 | Not conserved |
phastCons46way primates | 0.004 | Not conserved |
phastCons46way placental | 0.002 | Not conserved |
phastCons100way vertebrates | 0.068 | Not conserved |
phyloP46way primates | -0.352 | Not conserved |
phyloP46way placental | 0.272 | Not conserved |
phyloP100way vertebrates | 0.622 | Not conserved |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV001618535 | Benign | 2018-09-22 | criteria provided, single submitter | clinical testing | not provided | - | - | - |
RCV000289289 | Benign | 2018-01-13 | criteria provided, single submitter | clinical testing | Phenylketonuria | PKU | - | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |