| GRCh37/hg19 position | 12:103232280 |
| GRCh38/hg38 position | 12:102838502 |
| Alleles (ref/alt) | C/G |
| dbSNP rsid | rs977597724 |
| Gene symbol |
PAH |
| Most severe consequence | 3_prime_UTR_variant |
| Flanking sequence | TAAATGTCCTCAAAGTGTTTCCCAAAACAGA[C/G]TTGATAATTAATTGGAAAATGATACTGGAAG |
| HGVS |
NM_000277.3:c.*673G>C NM_001354304.2:c.*673G>C |
| Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
| NM_000277.3 | PAH | 13 | 3_prime_UTR_variant | c.*673G>C | - | 3' UTR | ||
| NM_001354304.2 | PAH | 14 | 3_prime_UTR_variant | c.*673G>C | - | 3' UTR |
| Database | Population | AC | AN | Hom | AF |
| gnomAD genomes | ALL | 2 | 30944 | 0 | 6.46329e-05 |
| FIN | 0 | 3488 | 0 | 0 | |
| NFE | 0 | 15000 | 0 | 0 | |
| ASJ | 0 | 302 | 0 | 0 | |
| EAS | 0 | 1614 | 0 | 0 | |
| AFR | 2 | 8728 | 0 | 0.000229148 | |
| AMR | 0 | 836 | 0 | 0 | |
| OTH | 0 | 976 | 0 | 0 |
| Method | Score | Level |
| GERP++ | -4.07 | Not conserved |
| phastCons46way primates | 0.133 | Not conserved |
| phastCons46way placental | 0.133 | Not conserved |
| phastCons100way vertebrates | 0 | Not conserved |
| phyloP46way primates | -0.142 | Not conserved |
| phyloP46way placental | -1.07 | Not conserved |
| phyloP100way vertebrates | -1.209 | Not conserved |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
| Benign | Pathogenic | |||||
|---|---|---|---|---|---|---|
| Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
| Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
| Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
| Functional data | BS3 | PP2 | PM1 | PS3 | ||
| Segregation data | BS4 | PP1 | PP1 | PP1 | ||
| De novo data | PM6 | PS2 | ||||
| Allelic data | BP2 | PM3 | ||||
| Other database | BP6 | PP5 | ||||
| Other data | BP5 | PP4 | ||||