| GRCh37/hg19 position | 12:103232239 |
| GRCh38/hg38 position | 12:102838461 |
| Alleles (ref/alt) | T/A |
| dbSNP rsid | rs958700803 |
| Gene symbol |
PAH |
| Most severe consequence | 3_prime_UTR_variant |
| Flanking sequence | ATATCTACCAACCAAGCCTTTAGTCAACATC[T/A]GCTGCATCATAAATGTCCTCAAAGTGTTTCC |
| HGVS |
NM_000277.3:c.*714A>T NM_001354304.2:c.*714A>T |
| Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
| NM_000277.3 | PAH | 13 | 3_prime_UTR_variant | c.*714A>T | - | 3' UTR | ||
| NM_001354304.2 | PAH | 14 | 3_prime_UTR_variant | c.*714A>T | - | 3' UTR |
| Database | Population | AC | AN | Hom | AF |
| gnomAD genomes | ALL | 1 | 30966 | 0 | 3.22935e-05 |
| FIN | 0 | 3492 | 0 | 0 | |
| NFE | 0 | 15002 | 0 | 0 | |
| ASJ | 0 | 302 | 0 | 0 | |
| EAS | 0 | 1616 | 0 | 0 | |
| AFR | 0 | 8736 | 0 | 0 | |
| AMR | 1 | 836 | 0 | 0.00119617 | |
| OTH | 0 | 982 | 0 | 0 |
| Method | Score | Level |
| GERP++ | 3.33 | Conserved |
| phastCons46way primates | 0.328 | Not conserved |
| phastCons46way placental | 0.328 | Not conserved |
| phastCons100way vertebrates | 0.003 | Not conserved |
| phyloP46way primates | 0.528 | Conserved |
| phyloP46way placental | 1.054 | Not conserved |
| phyloP100way vertebrates | 0.409 | Not conserved |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
| Benign | Pathogenic | |||||
|---|---|---|---|---|---|---|
| Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
| Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
| Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
| Functional data | BS3 | PP2 | PM1 | PS3 | ||
| Segregation data | BS4 | PP1 | PP1 | PP1 | ||
| De novo data | PM6 | PS2 | ||||
| Allelic data | BP2 | PM3 | ||||
| Other database | BP6 | PP5 | ||||
| Other data | BP5 | PP4 | ||||