| GRCh37/hg19 position | 12:103232156 |
| GRCh38/hg38 position | 12:102838378 |
| Alleles (ref/alt) | G/T |
| dbSNP rsid | rs535715056 |
| Gene symbol |
PAH |
| Most severe consequence | 3_prime_UTR_variant |
| Flanking sequence | CTAATACAAATAAAAATTTCACATTTATACA[G/T]ATTTGCTTTTCAATAATGTATTTACTTATTT |
| HGVS |
NM_000277.3:c.*797C>A NM_001354304.2:c.*797C>A |
| Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
| NM_000277.3 | PAH | 13 | 3_prime_UTR_variant | c.*797C>A | - | 3' UTR | ||
| NM_001354304.2 | PAH | 14 | 3_prime_UTR_variant | c.*797C>A | - | 3' UTR |
| Database | Population | AC | AN | Hom | AF |
| 1000 genomes | ALL | 1 | 5008 | - | 0.000199681 |
| EUR | - | - | - | 0 | |
| EAS | - | - | - | 0.001 | |
| SAS | - | - | - | 0 | |
| AFR | - | - | - | 0 | |
| AMR | - | - | - | 0 | |
| gnomAD genomes | ALL | 2 | 30948 | 0 | 6.46245e-05 |
| FIN | 0 | 3488 | 0 | 0 | |
| NFE | 0 | 14994 | 0 | 0 | |
| ASJ | 0 | 302 | 0 | 0 | |
| EAS | 2 | 1616 | 0 | 0.00123762 | |
| AFR | 0 | 8728 | 0 | 0 | |
| AMR | 0 | 838 | 0 | 0 | |
| OTH | 0 | 982 | 0 | 0 |
| Method | Score | Level |
| GERP++ | 0.303 | Not conserved |
| phastCons46way primates | 0 | Not conserved |
| phastCons46way placental | 0 | Not conserved |
| phastCons100way vertebrates | 0.013 | Not conserved |
| phyloP46way primates | -0.157 | Not conserved |
| phyloP46way placental | 0.044 | Not conserved |
| phyloP100way vertebrates | -0.237 | Not conserved |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
| Benign | Pathogenic | |||||
|---|---|---|---|---|---|---|
| Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
| Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
| Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
| Functional data | BS3 | PP2 | PM1 | PS3 | ||
| Segregation data | BS4 | PP1 | PP1 | PP1 | ||
| De novo data | PM6 | PS2 | ||||
| Allelic data | BP2 | PM3 | ||||
| Other database | BP6 | PP5 | ||||
| Other data | BP5 | PP4 | ||||