10:43615094:C/T
GRCh37/hg19 position 10:43615094
GRCh38/hg38 position 10:43119646
Alleles (ref/alt) C/T
dbSNP rsid rs1800862
Gene symbol

RET

Most severe consequence synonymous_variant
Flanking sequence ACCTGGGCAGTGGAGGCAGCCGCAACTCCAG[C/T]TCCCTGGACCACCCGGATGAGCGGGCCCTCA
HGVS

NM_020630.4:c.2508C>T

NM_020975.4:c.2508C>T

NP_065681.1:p.Ser836=

More...

Gene annotations
Transcript Gene Exon number Consequence HGVS cDNA HGVS protein Location Protein location
NM_020630.4 RET 19 synonymous_variant c.2508C>T p.Ser836= Exon 14
NM_020975.4 RET 20 synonymous_variant c.2508C>T p.Ser836= Exon 14
Population frequency
Select populations: ALL LWK MKK YRI EUR FIN NFE CEU ASJ TSI EAS SAS CHB HAN CHD JPT AFR AMR ASW GIH MEX OTH
Database Population AC AN Hom AF
1000 genomes ALL 180 5008 - 0.0359425
EUR - - - 0.0586
EAS - - - 0
SAS - - - 0.0849
AFR - - - 0.0129
AMR - - - 0.0303
ExAC ALL 5527 118460 188 0.046657
FIN 230 6484 4 0.035472
NFE 3173 64670 76 0.049064
EAS 13 8546 0 0.001521
SAS 1568 16506 99 0.094996
AFR 242 9938 2 0.024351
AMR 258 11442 6 0.022549
OTH 43 874 1 0.049199
gnomAD genomes ALL 1052 30898 25 0.0340475
FIN 117 3494 3 0.033486
NFE 650 14956 20 0.0434608
ASJ 13 302 0 0.0430464
EAS 1 1622 0 0.000616523
AFR 216 8706 2 0.0248105
AMR 19 838 0 0.022673
OTH 36 980 0 0.0367347
gnomAD exomes ALL 11131 245364 362 0.0453653
FIN 758 22250 16 0.0340674
NFE 5535 111044 137 0.0498451
ASJ 533 9832 8 0.0542107
EAS 15 17214 0 0.000871384
SAS 2916 30780 180 0.0947368
AFR 355 15212 2 0.0233368
AMR 765 33564 15 0.0227923
OTH 254 5468 4 0.0464521
CONVERGE ALL - - - 0.002
HRC ALL 3257 64976 - 0.0501262
Conservation scores are retrieved from UCSC genome browser. The conservation levels are defined by simple cutoff values. If the conservation levels do not agree with each other, you can manually check whether this variant is conserved with UCSC genome browser.
Method Score Level
GERP++ 2.51 Conserved
phastCons46way primates 0.913 Highly conserved
phastCons46way placental 1.000 Highly conserved
phastCons100way vertebrates 1.000 Highly conserved
phyloP46way primates 0.313 Not conserved
phyloP46way placental 0.262 Not conserved
phyloP100way vertebrates 2.608 Not conserved
ClinVar
Accession Clinical significance Date last evaluated Review status Method Disease name Disease symbol Disease inheritance Pubmed
RCV000264509 Likely benign 2016-06-14 criteria provided, single submitter clinical testing Hirschsprung Disease, Dominant - - -
RCV000203081 Benign/Likely benign 2016-06-14 criteria provided, multiple submitters, no conflicts clinical testing Multiple endocrine neoplasia - - -
RCV000327711 Likely benign 2016-06-14 criteria provided, single submitter clinical testing Pheochromocytoma - - -
RCV000151741 Benign 2016-10-31 criteria provided, multiple submitters, no conflicts literature only not specified - -

16091499

10980580

10022819

16118333

25741868

11589684

24033266

18976163

22111543

23059849

RCV000359214 Likely benign 2016-06-14 criteria provided, single submitter clinical testing Renal adysplasia RHDA1 - -
RCV000463335 Benign 2017-08-14 criteria provided, single submitter clinical testing Multiple endocrine neoplasia, type 2 MEN2 -

28492532

InterVar

InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.

Class: Benign
Benign Pathogenic
Strong Supporting Supporting Moderate Strong Very Strong
Population data BA1
BS1
BS2
PM2 PS4
Computational and predictive data BP1
BP3
BP4
BP7
PP3 PM4
PM5
PS1 PVS1
Functional data BS3 PP2 PM1 PS3
Segregation data BS4 PP1 PP1 PP1
De novo data PM6 PS2
Allelic data BP2 PM3
Other database BP6 PP5
Other data BP5 PP4
gnomAD
The Genome Aggregation Database (gnomAD), is a coalition of investigators seeking to aggregate and harmonize exome and genome sequencing data from a variety of large-scale sequencing projects, and to make summary data available for the wider scientific community. In its first release, which contained exclusively exome data, it was known as the Exome Aggregation Consortium (ExAC).